/BCO-DMO/C-AIR/pseudonitzschia_asv ---- Level 0

      Directory  DocumentationDownload and Other Operations...

 - At level 0 -  - At last level -       Flat list

#   Pseudo-nitzschia amplicon sequence variants (ASVs) 
#     from weekly samples and offshore cruises with the Northeast U.S. Shelf (NES) Long-Term Ecological Research (LTER)
#   PI: B. Jenkins, M. Bertin, A. Sterling (URI)
#   version date: 2021-04-05
# 
=========================
Sequence_ID    Sequence_of_ASV                                                                                                                                                                                                                                                                                                                                NCBI_GenBank_Accession_Number    Pseudo_nitzschia_species                    ASV_Number_on_Sterling_et_al_Figures    ID_Method            Threshold_Pass    Notes                                                                         
-------------------------
ASV_seq01      AAGGATCATTACCACACCGATCCAAGATCAGTCTTCATTGTGAATCTGATTGCACCGGTCTAGTATTTTTACTAAACTGCTGCCGTCAAACTTAAACTTGCAACGCGTTGATTAATTCCGCGTTGCTGCCATTCTTTACGATTGGTAACTGGAAAGAACCAAATGACCTAAAGTAGAAATGATGCAGTGTTTCGGAGCGCTGAGCGGGCGTCTTAAGTATTAGATGCATACCAAACCGACTCTATTGCTGGCACTGCACATTACACCCTAATACA                                                            MW447658                         Pseudo-nitzschia pungens var. pungens       1                                       QIIME2 naiveBayes    YES               nd                                                                            
ASV_seq02      AAGGATCATTACCACACCGATCCAAGATCAGTCTTCATTGTGAATCTGATTGCAGTGGCTTAGGTTTTTAATCTAGACTACTGTAGTCAAACTTAACCGGCAACCCTCGAGAGTAATCTCGGGTTGCCCGCCACTCTTTACGATTGGTAACTGGAAAGAACCAAATGACCTAAAGCTAAAATGCAGAGGCTTGGCACTGATACTTTGCTGTCAGTGTGGCCCTGCAGATTATACCTAATACA                                                                                             MW447659                         Pseudo-nitzschia multiseries                1                                       QIIME2 naiveBayes    YES               nd                                                                            
ASV_seq03      AAGGATCATTACCACACCGATCCAAGATCAGTCTTCATTGTGAATCTGATTTCAGAGGCAGCCTCGCTGTTCTCTGTCGTCAACTTTAACCCTGGTGCTATCCAGCCCGTGCAATACCTTGTGTTTGTGTGGGTTGGTTGGTGTCCACTTTACCCCCCATATTCTATATGGAAACTGGAAAGAACCAAATGACCTAAAGCTAAAGTGCAGTTGGTCTGGTGTTGCGCCTTGTGCCAACACCGCCCTGTACACAAACCTAATGAC                                                                       MW447660                         Pseudo-nitzschia delicatissima              1                                       QIIME2 naiveBayes    YES               nd                                                                            
ASV_seq04      AAGGATCATTACCACACCGATCCAAGATCAGTCTTCATTGTGAATCTGATTTCAGAGGCGGCTTGCTTTTAAAGCTCTCCGTCTCTGTCGTCAAACTTTTTTAGTGATGCGCTAGCTACTAGCGTATTACAACCCCCCATTCTTAACGATTGGTAACTGGAAAGAACCAAATGACCTAAAGCTAAAATGCAGTGGTCTGGTGTTGCGCCTCGTGCCAACACCGCCCTGTACATTATACCAATTCA                                                                                          MW447661                         Pseudo-nitzschia australis                  1                                       QIIME2 naiveBayes    YES               nd                                                                            
ASV_seq05      AAGGATCATTACCACACCGATCCAAGATCAGTCTTCATTGTGAATATGATTTCAGGCTCGGTGCCAGCTAGGCTGGTGCTGTTTCTGTCGTCAACCTTTTTCTATGGAGCCGGCGCACTTGCTGTTGCAATTACTGCAAGGGCGTGTGCGCTAGTTCCAGTGGTGCATCGTCACCACAACCCCCATTCTTTACGATTGGTAACTGGAAAGAACCAAATGACCTAAAGCAAAAATGCAGCGGTCCGGTGTCGTGCTTCGTGCCGACGCCGCCCTGTACATTATACCTAATAACA                                          MW447662                         Pseudo-nitzschia americana                  1                                       QIIME2 naiveBayes    YES               nd                                                                            
ASV_seq06      AAGGATCATTACCACACCGATCCAAGATCTGTCTTCATTGTGAATCTGATTGCGCGAGTACCATTAGCATTAGCTTTTGCTGCTAGCGCCGTCAAACTTATATATTTCCTTGTGGTCCCGCCCGAGCTGGTTTTACTAGCGAAGGCCGCACTGCCTGGATCTTACTTTCAGGAGCGAGCACTGCTTAGCAACTTACACGCCCACCCCCCATGTATATTATTTTATATGGTAACTGGACCGAACCAAATGACCTAAAGCTTAAAGTGCAGTAGGAAGCATCGTGCTACTTGTAGCCGGTGCGGCCCTGTACAAAAACCTAATGAC           MW447663                         Pseudo-nitzschia plurisecta                 1                                       QIIME2 naiveBayes    YES               nd                                                                            
ASV_seq08      AAGGATCATTACCACACCGATCCAAGATCTGTCTTCATTGTGAATTCGGATGGCATGGGCAGCAGCTTGACTGCTGTACTATGTCGTCCACTGTGTTTGGCTCGTGACTTTTGTTGCGAGCCATCCATATTTCTTCTATATGGTAAAACAATTTATATGTAATTTGCTGATTTTACTAACTAGTTTTACTACTACTAGTACTAATCTGCAAGATCCAAATGACCTAAAGCTTAAAGTGCAGCTGGTCCGGTGTTGTGCCTCGTGCCAACACTACCCTGTACACAAAACCTAATGAC                                       MW447665                         Pseudo-nitzschia calliantha                 1                                       QIIME2 naiveBayes    YES               nd                                                                            
ASV_seq09      AAGGATCATTACCACACCGATCCAAGATCAGTCTTCATTGTGAATATGATTTCAGATTCTGGTGCCAGCTAGCCTGGTGCTGCTTCTGTCGTCAACCTTTTTCTATGGAGCCGGCGCATTTGCTGTTGCTATTTATACTGGCAAGGGCGTGTGCGCTAGTTCCAGTGGTGCTTTGTCACCACAACCCCCATTCTTTACGATTGGTAACTGGAAAGAACCAAATGACCTAAAGCAAAAATGCAGCGGTCCGGTGTCGTGCCTCGTGCCGACGCCGCCCTGTACATTATACCTAATAACA                                     MW447666                         Pseudo-nitzschia sp.                        1                                       megablast            YES               Closest similarity to P. americana. Referred to as Group1 in manuscript.      
ASV_seq107     AAGGATCATTACCACACCGATCCAAGATCTGTCTTCATTGTGAATCTGATTTCAGGGGCAGCCGGTCAATTCTTTGATAAGCTGTTCTCTGTCGTCAACTTTAAACTTGGTGCTAGTCTGCGCAACACTATGTGCTGCCTTGCTAGTATCACTTATATATCTGCGACCTCTGCTTCGGCATCGTTTCACGCACCCCCCCATTCTAAATGGAAACTGGAAAGAACCAAATGACCTAAAGCTTAAAGTGCAGTTGGTCTGGTGTTGAGCCTTGTGCCCAACACCACCCTGTACACAAACCTAATGAC                              MW447764                         Pseudo-nitzschia fryxelliana                1                                       QIIME2 naiveBayes    YES               nd                                                                            
ASV_seq11      AAGGATCATTACCACACCGATCCAAGATCAGTCTTCATTGTGAATTTGATTTGCGTGGCACTCTGGCTTCGGCCCGTTTGCCTCAAAAGTCAACTTGTATACAGGTGGCCTTGTCCCCCCCTGCGCACAGTATACCTGTGTTCGGCGCGCGACATCGCACCAGTGGCATTAAGTGAAATGTCCACACCCCATCTTTTACGATCGGTAACTTGATAGAACCAAATGACCTAAAGCTTAAAGTGCAGTGGTCCGGCAACTGAGCCTTGTGCCAGGAGCCGCCCTGTACATAAAACCTAATGAC                                  MW447668                         Pseudo-nitzschia fraudulenta                1                                       QIIME2 naiveBayes    YES               nd                                                                            
ASV_seq12      AAGGATCATTACCACACCGATCCAAGATCTGTCTTCATTGTGAATTCGGATGGCATTGGCAGCATTAACGTGCTGTACTTTGTCGTCCACTGTGTTTGGCTTGTATTTGCGTGCAGATGCAGGCCATCCATATTTCTTCTATATGGTAAAACTTATATGAAATTTGTTGATTCTAGTCTTTACTAGTAATCTGCAAGACCGAAATGACCTAAAGCTAAAGTGCAGCTGGTTTGGTGTTGAGCTTCGTGCCAGCACCACCCTGTACATAAAACCTAATGAC                                                       MW447669                         Pseudo-nitzschia hasleana                   1                                       QIIME2 naiveBayes    YES               nd                                                                            
ASV_seq14      AAGGATCATTACCACACCGATCCAAGATCTGTCTTCATTGTGAATCTGATTTCAGTAGCTACTTTAGCATACTGTCGTCAAACTTCATCGCGGTGCAGTCTTTTGACTGTCTCGTTAGTCCAAAAACACTCCCATTCTATATGGAAACCGGCTTAACCAAATGACCTAAAGCTAAAAGTGCAGCTGGTCTGGTGCTTAGCACCGTGTGCCCTGTACAAAAACCTAATGACTT                                                                                                       MW447671                         Pseudo-nitzschia galaxiae                   1                                       QIIME2 naiveBayes    YES               nd                                                                            
ASV_seq16      AAGGATCATTACCACACCGATCCAAGATCTGTCTTCATTGTGAATCTGATTTCGTTGACAGTCCTTCAGTGGGCTGTACTTCGTCGTCAACATTATTGGGATATGCTGCCATTACCCACTGTGGTGATGGTAGTTGTCCCGCGATCTGCCATATCAGCCTTGTGCTGTAGCGGGTCGCAAACCCCCCATTCTATATGGTAACCGGAAAGAACCAAATGACCTAAAGTAAAATGTGCAGATGGTCTGGTGTTGTGCTTAGTGCCAACACTGATCCTGTACACAAAACCTAATGAC                                         MW447673                         Pseudo-nitzschia subpacifica                1                                       QIIME2 naiveBayes    YES               nd                                                                            
ASV_seq18      AAGGATCATTACCACACCGATCCAAGATCTGTCTTCATTGTGAATCTGATTGCGCTAGTAGTAAAGTAATTTATTTTGCTGCTAGCACCGTCAAACTTATATATTTCCTTGTGGTCCCGCCCGAGCTGGTAGTTTTACTGCTAGCGGAGGCCGCACTGCCTGGATCTTACTATTCAGGAGCGAGCACTGCTTAGCAACTTACACGCCCACCCCCCCATGTATATTTTATATGGTAACTGGACCGAACCAAATGACCTAAAGCTTAAAGTGCAGTAGGAAGCATCGTGCTACTTGTAGCCGGTGCGGCCCTGTACAAAAACCTAATGAC       MW447675                         Pseudo-nitzschia cuspidata                  1                                       QIIME2 naiveBayes    YES               nd                                                                            
ASV_seq22      AAGGATCATTACCACACCGATCCAAGATCAGTCTTCATTGTGAATCTGATTTCAGGGGCAGCCATCTGCTATTATATAGCTTTGGCTGTTCTCTGTCGTCAAACTTAACTTATATTTTTATGCGCGACCTCTGCTTCGGCATCGTTTCACGCCCACCCCCCATTTCTATATGGTAACTGGAAAGAACCAAATGACCTAAAGCTAAAAGTGCAGCTGGTTTGGTGTTGAGCCTCGTGTTCAACACCACCCTGTACATTAAACCTAATGAC                                                                  MW447679                         Pseudo-nitzschia inflatula                  1                                       QIIME2 naiveBayes    YES               nd                                                                            
ASV_seq34      AAGGATCATTACCACACCGATCCAAGATCAGTCTTCATTGTGAATTCGATTGCAGTGGCAACTGGCTCATCTAGAGTCTTTTGTCAGTGTCGTCAACTTTCTGCTAGGTGACGAGCTTGCATAGTAATAGCCTGCCAGTATTGTATTGTATACATATCACTGGCAGAGCTAATGCATTCTTCCACTGGCCCCCCCAATTCTTATTCTTAACGATTGGTAACTGGAAAGAACCAACTGACCTGAAGCAAAAATGCAGAGGTTAGGCGCTGCGCCTTGTTGCCAGTGCCACCCTGTACATTATACCTAATACA                        MW447691                         Pseudo-nitzschia multistriata               1                                       QIIME2 naiveBayes    YES               nd                                                                            
ASV_seq39      AAGGATCATTACCACACCGATCCAAGATCAGTCTTCATTGTAAATCCGATTTCAGAGGCAGCTTCTGGTTGTTCTCTGTCGTCAACTTTAATATGGTACTAGCTTGCTAGAACCAGTGACCTCTGTTTCACGTCACACCCCCCATTCTATATGGTAACTGGAAAGAACCAAATGACCTAAAGCTTAAAGTGCAGCTGGTCTGGTATCGTGCCTTGTGCCGATGCCACCCTGTACAAAAAACCTAATGAC                                                                                      MW447696                         Pseudo-nitzschia turgidula                  1                                       QIIME2 naiveBayes    YES               nd                                                                            
ASV_seq42      AAGGATCATTACCACACCGATCCAAGATCTGTCTTCATTGTGAATCTGATTTCGTTGACAGTCCTTCAGTGGGCTGTACTTCATCGTCAACATTATTGGGATATGCTGTCATTGCCCACTGTGGTGATGGTAGTTGTCCTGCGATCTGCCATATCAGCCTTGTGCTGTAGCGGGTCGCAAACCCCCCATTCTATATGGTAACCGGAAAGAACCAAATGACCTAAAGTAAAATGTGCAGATGGTCTGGTGTTGTGCTTAGTGCCAACACCAATCCTGTACACAAAGCCTAATAAC                                         MW447699                         Pseudo-nitzschia heimii                     1                                       QIIME2 naiveBayes    YES               nd                                                                            
ASV_seq75      AAGGATCATTACCACACCGATCCAAGATCTGTCTTCATTGTGAATCTGATCGCGTTGGCAGTCCCCTAGCGGGCTGTACTTCGTCGTCAAAATTTTTTGGGATATGCTGTCACTGCTTGCATCAGAATGAAGTGAGTGGTGATGGTAGTTGTCCCGCAACCCTGCCCTTGCAGTCACAGGTCACACTGTGGCTGCTGCGGGGTTGCTAACACCCCCCATTATTCTATATGGTAACCGGAAAGAACCAAATGACCTAAAGTAAAATGTGTAGTCGGTCCGGTGTTGGCCTAGTGCCACACCTACCCTGCACACAAAACCTAATGAC          MW447732                         Pseudo-nitzschia caciantha                  1                                       QIIME2 naiveBayes    YES               nd                                                                            
ASV_seq81      AAGGATCATTACCACACCGATCCAAGATCTGTCTTCATTGTGAATCTGATTTCAGGGGCAACTAGTCTCTAGTTGTTCTCTGTCGTCAACTTTTGTTTGATTCTAGCTTGCTGGAATCAGTGACCTCTGTTTCATGTCACAACCCCCATTCTATATGGTAACTGGAAAGAACCAAATGACCTAAAGCCTAAAGTGCAGTGGTATGGTGTTGTCCTTTTGGTCAGCACCACCTGTACACAAAACCTAATGAC                                                                                    MW447738                         Pseudo-nitzschia lineola                    1                                       QIIME2 naiveBayes    YES               nd                                                                            
ASV_seq07      AAGGATCATTACCACACCGATCCAAGATCAGTCTTCATTGTGAATATGATTTCAGGCTCGGTGCCAGCTAGTCTGGTGCTGTTTCTGTCGTCAACCTTTTTCTATGGAGCCGGCGCACTTGCTGTTGCAATTACTGCAAGGGCGTGTGCGCTAGTTCCAGTGGTGCATCGTCACCACAACCCCCATTCTTTACGATTGGTAACTGGAAAGAACCAAATGACCTAAAGCAAAAATGCAGCGGTCCGGTGTCGTGCTTCGTGCCGACGCCGCCCTGTACATTATACCTAATAACA                                          MW447664                         Pseudo-nitzschia americana                  2                                       QIIME2 naiveBayes    YES               nd                                                                            
ASV_seq10      AAGGATCATTACCACACCGATCCAAGATCTGTCTTCATTGTGAATTCGGATGGCATGGGCAGCAGCTTGACTGCTGTACTATGTCGTCCACTGTGTTTGGCTCGTGACTTTTGTTGCGAGCCATCCATATTTCTTCTATATGGTAAAACAATTTATATGTAATTTGCTGATTTTACTAACTAGTTTTACTACTAGTAGTACTAATCTGCAAGATCCAAATGACCTAAAGCTAAAGTGCAGCTGGTCCGGTGTTGTGCCTCGTGCCAACACTACCCTGTACACAAAACCTAATGAC                                        MW447667                         Pseudo-nitzschia calliantha                 2                                       megablast            YES               nd                                                                            
ASV_seq106     AAGGATCATTACCACACCGATCCAAGATCTGTCTTCATTGTGAATCTGATTGCGCGAGTACCATTAGCATTAGCTTTTGCTGCTAGCGCCGTCAAACTTATATATTTCCTTGTGGTCCCGCCCGAGCTGGTTTTACTAGCGAAGGCCGCACTGCCTGGATCTTACTTTCAGGAGCGAGCACTGCTTAGCAACTTACACGCCCACCCCCCATGTATATTATTTTATATGGTAACTGGACCGAACCAAATGACCTAAAGCTTAAAGTGCAGTAGGAAGCATCGTGCTACTTGTAGCCGGTGCAGCCCTGTACAAAAACCTAATGAC           MW447763                         Pseudo-nitzschia plurisecta                 2                                       QIIME2 naiveBayes    YES               nd                                                                            
ASV_seq15      AAGGATCATTACCACACCGATCCAAGATCAGTCTTCATTGTGAATCTGATTGCAGTGGCTTAGGTTTTTAATCTAGACTACTGTAGCCAAACTTAACCGGCAACCCTCGAGAGTAATCTCGGGTTGCCCGCCACTCTTTACGATTGGTAACTGGAAAGAACCAAATGACCTAAAGCTAAAATGCAGAGGCTTGGCACTGATACTTTGCTGTCAGTGTGGCCCTGCAGATTATACCTAATACA                                                                                             MW447672                         Pseudo-nitzschia multiseries                2                                       QIIME2 naiveBayes    YES               nd                                                                            
ASV_seq19      AAGGATCATTACCACACCGATCCAAGATCAGTCTTCATTGTGAATCTGATTTCAGAGGCGGCTTGCTTTTAAAGCTCTCCGTCTCTGTCGTCAAACTCTTTTAGTGATGCGCTAGCTACTAGCGTATTACAACCCCCCATTCTTAACGATTGGTAACTGGAAAGAACCAAATGACCTAAAGCTAAAATGCAGTGGTCTGGTGTTGCGCCTCGTGCCAACACCGCCCTGTACATTATACCAATTCA                                                                                          MW447676                         Pseudo-nitzschia australis                  2                                       QIIME2 naiveBayes    YES               nd                                                                            
ASV_seq21      AAGGATCATTACCACACCGATCCAAGATCTGTCTTCATTGTGAATCTGATTTCGTTGACAGTCCTTCAGTGGGCTGTACTTCGTCGTCAACATTATTGGGATATGCTGCCATTACCCACTGTGGTGATGGTAGTTGTCCCGCGATCTGCCATATCAGCCTTGTGCTGTAGCGGGTCGCAAACCCCCCATTCTATATGGTAACCGGAAAGAACCAAATGACCTAAAGTAAAATGTGCAGATGGTCTGGTGTTGTGCTTAGTGCCAACACCGATCCTGTACACAAAACCTAATGAC                                         MW447678                         Pseudo-nitzschia subpacifica                2                                       QIIME2 naiveBayes    YES               nd                                                                            
ASV_seq23      AAGGATCATTACCACACCGATCCAAGATCTGTCTTCATTGTGAATCTGATTTCAGTAGCTACTTTAGCATACTGTCGTCAAACTTCATCGCGGTGCAGTCTTTTGACTGTCTCGTTAGTCCAAAAACACTCCCATTCTATATGGAAACCGGTTTAACCAAATGACCTAAAGCTAAAAGTGCAGCTGGTCTGGTGCTTAGCACCGTGTGCCCTGTACAAAAACCTAATGACTT                                                                                                       MW447680                         Pseudo-nitzschia galaxiae                   2                                       QIIME2 naiveBayes    YES               nd                                                                            
ASV_seq25      AAGGATCATTACCACACCGATCCAAGATCAGTCTTCATTGTGAATCTGATTTCAGAGGCAGCCTCGCTGTTCTCTGTCGTCAACTTTAACACTGGTGCTATCCAGCCCGTGCAATACCTTGTGTTTGTGTGGGTTGGTTGGTGTCCACTTTACCCCCCATATTCTATATGGAAACTGGAAAGAACCAAATGACCTAAAGCTAAAGTGCAGTTGGTCTGGTGTTGCGCCTTGTGCCAACACCGCCCTGTACACAAACCTAATGAC                                                                       MW447682                         Pseudo-nitzschia delicatissima              2                                       QIIME2 naiveBayes    YES               nd                                                                            
ASV_seq26      AAGGATCATTACCACACCGATCCAAGATCTGTCTTCATTGTGAATCTGATTGCGCTAGTAGCATTGATAACTAGCTTACCTTTGCTGCTAGTGCCGTCAAACTTATATATTTCCTTGTGGTCCCGCCCGAGCTGGTTTTACTAGCAGAGGCCGCACTGCCTGGATCTTACTTTTTAGGAGCGAGCACTGCTTAGCAACTTACACGCCCACCCCCCATGTATATTTCTATATGGTAACTGGACCGAACCAAATGACCTAAAGCTTAAAGTGCAGTAGGAAGCATCGCGCTACTTGTAGCCGGTGCAGCCCTGTACAAAAACCTAATGAC       MW447683                         Pseudo-nitzschia cuspidata                  2                                       megablast            YES               nd                                                                            
ASV_seq29      AAGGATCATTACCACACCGATCCAAGATCAGTCTTCATTGTGAATTTGATTTGCGTGGCACTCTGGCTTCGGCCCGTTTGCCTCAAAAGTCAACTTGTATACAGGTGGCCTTGTCCCCCCCTGCGCACAGTACACCTGTGTTCGGCGCGCGACATCGCACCAGTGGCATTAAGTGAAATGTCCACACCCCATCTTTTACGATCGGTAACTTGATAGAACCAAATGACCTAAAGCTTAAAGTGCAGTGGTCCGGCAACTGAGCCTTGTGCCAGGAGCCGCCCTGTACATAAAACCTAATGAC                                  MW447686                         Pseudo-nitzschia fraudulenta                2                                       QIIME2 naiveBayes    YES               nd                                                                            
ASV_seq33      AAGGATCATTACCACACCGATCCAAGATCAGTCTTCATTGTGAATATGATTTCAGATTCTGGTGCCAGCTAGCCTGGTGCTGCTTCTGTCGTCACCCTTTTTCTATGGAGCCGGCGCATTTGCTGTTGCTATTTAATACTGGCAAGGGCGTGTGCGCTAGTTCCAGTGGTGCTTTGTCACCACAACCCCCATTCTTTACGATTGGTAACTGGAAAGAACCAAATGACCTAAAGCAAAAATGCAGCGGTCCGGTGTCGTGCCTCGTGCCGACGCCGCCCTGTACATTATACCTAATAACA                                    MW447690                         Pseudo-nitzschia sp.                        2                                       megablast            YES               Closest similarity to P. americana. Referred to as Group1 in manuscript.      
ASV_seq38      AAGGATCATTACCACACCGATCCAAGATCAGTCTTCATTGTGAATTCGATTGCAGTGGCAACTGGCTCATCTAGAGCCTTTTGTCAGTGTCGTCAACTTTCTGCTAGGTGACGAGCTTGCATAGTAATAGCCTGCCAGTATTGTATTGCATTGTATTGTATATATATCACTGGCAGAGCTAATGCATTCTTCCACTGGCCCCCCCAATTCTTATTCTTAACGATTGGTAACTGGAAAGAACCAACTGACCTGAAGCAAAAATGCAGAGGTTAGGCGCTGCGCCTTGTTGCCAGCGCCACCCTGTACATTATACCTAATACA              MW447695                         Pseudo-nitzschia multistriata               2                                       QIIME2 naiveBayes    YES               nd                                                                            
ASV_seq45      AAGGATCATTACCACACCGATCCAAGATCAGTCTTCATTGTGAATCTGATTGCACCGGTCTAGTATTTTTACTAAACTGCTGCCGTCAAACTTAAACTTGCAACGCGTTGATTAATTCCGCGTTGCTGCCATTCTTTACGATTGGTAACTGGAAAGAACCAAATGACCTAAAGTAGAAATGATGCAGTGTTTCGGAGCGCTGAGCGGGCGTCTTAAGTATTAGATGCATACCAAACTGACTCTATTGCTGGCACTGCACATTACACCCTAATACA                                                            MW447702                         Pseudo-nitzschia pungens var. pungens       2                                       QIIME2 naiveBayes    YES               nd                                                                            
ASV_seq65      AAGGATCATTACCACACTGATCCAAGATCTGTCTTCATTGTGAATCTGATTTCGTTGACAGTCCTTCAGTGGGCTGTACTTCGTCGTCAACATTATTGGGATATGCTGTCATTGCCCACTGTGGTGATGGTAGTTGTCCCGCGATCTGCCATATCAGCCTTGTGCTGTAGCGGGTCGCAAACCCCCCCATTCTATATGGTAACCCGAAAGAACCAAATGACCTAAAGTAAAATGTGCAGATGGTCTGGTGTTGTGCTTAGTGCCAACACCGATCCTGTACACAAAACCTAATGAC                                        MW447722                         Pseudo-nitzschia heimii                     2                                       QIIME2 naiveBayes    YES               nd                                                                            
ASV_seq84      AAGGATCATTACCACACCGATCCAAGATCTGTCTTCATTGTGAATCTGATCGCGTTGGCAGTCCCCTAGCGGGCTGTACTTCGTCGTCAAAATTTTTTGGGATATGCTGTCACTGCTTGCATCAGAATGAAGTGAGTGGTGATGGTAGTTGTCCCGCAACCCTGCCCTTGCAGTCACAGGTCACTCTGTGGCTGCTGCGGGGTTGCTAACACCCCCCATTATTCTATATGGTAACCGGAAAGAACCAAACGACCTAAAGTAAAATGTGTAGTCGGTCCGGTGTTGGCCTAGTGCCACACCTACCCTGCACACAAAACCTAATGAC          MW447741                         Pseudo-nitzschia caciantha                  2                                       QIIME2 naiveBayes    YES               nd                                                                            
ASV_seq89      AAGGATCATTACCACACCGATCCAAGATCAGTCTTCATTGTGAATCTGATTTCAGGGGCAGCTTTGGCTGTTCTCTGTCGTCAAACTTAACTTATATTTTTTAGCGCGACCTCTGCTTCGGCATCGTTTCACGCCCACCCCCCATTTCTATATGGTAACTGGAAAGAACCAAATGACCTAAAGCCAAAAGTGCAGCTGGTCTGGTGTTGAGCCTTGTGTTCACACCACCCTGTACATAAAACCTAATGAC                                                                                     MW447746                         Pseudo-nitzschia inflatula                  2                                       QIIME2 naiveBayes    YES               nd                                                                            
ASV_seq13      AAGGATCATTACCACACCGATCCAAGATCAGTCTTCATTGTGAATCTGATTGCACCGGTCTAGTATTTTTACTAAACCGCTGCCGTCGAACTTAAACTTGCAACGCGATGATTAATTCCGCCTTGCTGCCATTCTTTACGATTGGTAACTGGAAAGAACCAAATGACCTAAAGCAAAAATGATGCAGTGTTTCGGAGCGCTGAGCGGGCGTCTTAAGTATTAGATGCATACCAAACCGACTCTATTGCTGGCACTGCACATTACACCTAATACA                                                             MW447670                         Pseudo-nitzschia pungens var. aveirensis    3                                       QIIME2 naiveBayes    YES               nd                                                                            
ASV_seq17      AAGGATCATTACCACACCGATCCAAGATCTGTCTTCATTGTGAATTCGGATGGCATGGGCAGCAGCTTGACTGCTGTACTATGTCGTCCACTGTGTTTGGCTCGTGACTTTTGTTGCGAGCCATCCATATTTCTTCTATATGGTAAAACAATTTATATGTAATTTGCTGATTTTACTAACTAGTCTTAGTACTACTAGTACTAATCTGCAAGATCCAAATGACCTAAAGCTAAAGTGCAGCTGGTTTGGTGTTGTGCCTCGTGCCAACACTACCCTGTACACAAAACCTAATGAC                                        MW447674                         Pseudo-nitzschia calliantha                 3                                       megablast            YES               nd                                                                            
ASV_seq20      AAGGATCATTACCACACCGATCCAAGATCAGTCTTCATTGTGAATATGATTTCAGGCTCGGTGCCAGCTAGGCTGGTGCTGTTTCTGTCGTCAACCTTTTTCTATGGAGCCGGCGCACTTGCTGTTGCAATTACTGCAAGGGCGTGTGCGCTAGTTCCAGTGGTGCATCGTCACCACAACCCCCATTCTTTACGATTGGTAACTGGAAAGAACCAAATGACCTAAAGCAAAAATGCAGCGGTCCGGTGTCGTGCTTCGTGCTGACGCCGCCCTGTACATTATACCTAATAACA                                          MW447677                         Pseudo-nitzschia americana                  3                                       QIIME2 naiveBayes    YES               nd                                                                            
ASV_seq24      AAGGATCATTACCACACCGATCCAAGATCTGTCTTCATTGTGAATCTGATTTCAGTAGCTACTTTAGCATACTGTCGTCAAACTTCATCGCGGTGCAGTCTTTTGACTGTCTCGTTAGTCCAAAAACACTCCCATTCTATATGGAAACCGGCTTAACCAAATGACCTGAAGCTAAAAGTGCAGCTGGTCTGGTGCTTAGCACCGTGTGCCCTGTACAAAAACCTAATGACTT                                                                                                       MW447681                         Pseudo-nitzschia galaxiae                   3                                       QIIME2 naiveBayes    YES               nd                                                                            
ASV_seq36      AAGGATCATTACCACACCGATCCAAGATCAGTCTTCATTGTGAATCTGATTTCAGAGGCAGCCTCGCTGTTCTCTGTCGTCAACTTTAACCCTGGTGCTATCCAGCCCGTGCAATACCTTGTGTTTGTGTGGGTTGGTTGGTGTCCACTTTACCCCCCATATTCTATATGGAAACTGGAAAGAAACAAATGACCTAAAGCTAAAGTGCAGTTGGTCTGGTGTTGCGCCTTGTGCCAACACCGCCCTGTACACAAACCTAATGAC                                                                       MW447693                         Pseudo-nitzschia delicatissima              3                                       QIIME2 naiveBayes    YES               nd                                                                            
ASV_seq43      AAGGATCATTACCACACCGATCCAAGATCTGTCTTCATTGTGAATCTGATTGCGCTAGTAGTAAAGTAATTTATTTTGCTGCTAGCACCGTCAAACTTATATATTTCCTTGTGGTCCCGCCCGAGCTGGTAGTTTTACTGCTAGCGGAGGCCGCACTGCCTGGATCTTACTATTCAGGAGCGAGCACTGCTTAGCAACTTACACGCCCACCCCCCCATGTATTTTTTATATGGTAACTGGACCGAACCAAATGACCTAAAGCTTAAAGTGCAGTAGGAAGCATCGTGCTACTTGTAGCCGGTGCGGCCCTGTACAAAAACCTAATGAC       MW447700                         Pseudo-nitzschia cuspidata                  3                                       QIIME2 naiveBayes    YES               nd                                                                            
ASV_seq62      AAGGATCATTACCACACCGATCCAAGATCTGTCTTCATTGTGAATATGATTTCGTTGACAGTCCTTCAGTGGGCTGTACTTCGTCGTCAACATTATTGGGATATGCTGCCATTACCCACTGTGGTGATGGTAGTTGTCCCGCGATCTGCCATATCAGCCTTGTGCTGTAGCGGGTCGCAAACCCCCCATTCTATATGGTAACCGGAAAGAACCAAATGACCTAAAGTAAAATGTGCAGATGGTCTGGTGTTGTGCTTAGTGCCAACACCGATCCTGTACACAAAACCTAATGAC                                         MW447719                         Pseudo-nitzschia subpacifica                3                                       QIIME2 naiveBayes    YES               nd                                                                            
ASV_seq79      AAGGATCATTACCACACCGATCCAAGATCAGTCTTCATTGTGAATATGATTTCAGATTCTGGTGCCTGCTAGCCTGGTGCTGCTTCTGTCGTCAACCTTTTTCTATGGAGCCGGCGCATTTGCTGTTGCTATTTATACTGGCAAGGGCGTGTGCGCTAGTTCCAGTGGTGCTTTGTCACCACAACCCCCATTCTTTACGATTGGTAACTGGAAAGAACCAAATGACCTAAAGCAAAAATGCAGCGGTCCGGTGTCGTGCCTCGTGCCGACGCCGCCCTGTACATTATACCTAATAACA                                     MW447736                         Pseudo-nitzschia sp.                        3                                       megablast            YES               Closest similarity to P. americana. Referred to as Group1 in manuscript.      
ASV_seq96      AAGGATCATTACCACACCGATCCAAGATCTGTCTTCATTGTGAATCTGATCGCGTTGGCAGTCCCCTAGCGGGCTGTACTTCGTCGTCAAAATTTTTTGGGATATGCTGTGACTGCTTGCATCAGAATGAAGCGAGTGGTGATGGTAGTTGTCCCGCAACCCTGCCCTTGCAGTCACAGGTCACACTGTGGCTGCTGCGGGGTTGCTAACACCCCCCATTATTCTATATGGTAACCGGAAAGAACCAAATGACCTAAAGTAAAATGTGTAGTCGGTCCGGTGTTGGCCTAGTGCCACACCTACCCTGCACACAAAACCTAATGAC          MW447753                         Pseudo-nitzschia caciantha                  3                                       QIIME2 naiveBayes    YES               nd                                                                            
ASV_seq27      AAGGATCATTACCACACCGATCCAAGATCTGTCTTCATTGTGAATTCGGATGGCATGGGCAGCAGCTTGACTGCTGTACTATGTCGTCCACTGTGTTTGGCTCGTGACTTTTGTTGCGAGCCATCCATATTTCTTCTATATGGTAAAACAATTTATATGTAATTTGCTGATTTTACTAACTAGTCTTAGTACTACTAGTACTAATCTGCAAGATCCAAATGACCTAAAGCTAAAGTGCAGCTGGTCCGGTGTTGTGCCTCGTGCCAACACTACCCTGTACACAAAACCTAATGAC                                        MW447684                         Pseudo-nitzschia calliantha                 4                                       megablast            YES               nd                                                                            
ASV_seq30      AAGGATCATTACCACACCGATCCAAGATCTGTCTTCATTGTAAATCTGATTTCAGTAGCTACTTTAGCATACTGTCGTCAAACTTCATCGCGGTGCAGTCTTTTGACTGTCTCGTTAGTCCAAAAACACTCCCATTCTATATGGAAACCGGCTTAACCAAATGACCTAAAGCTAAAAGTGCAGCTGGTCTGGTGCTTAGCACCGTGTGCCCTGTACAAAAACCTAATGACTT                                                                                                       MW447687                         Pseudo-nitzschia galaxiae                   4                                       QIIME2 naiveBayes    YES               nd                                                                            
ASV_seq55      AAGGATCATTACCACACCGATCCAAGATCAGTCTTCATTGTGAATATGATTTCAGGCTCGGTGCCAGCTAGTCTGGTGCTGTTTCTGTCGTCAACCTTTTTCTATGGAGCCGGCGCACTTGCTGTTGCAATTACTGCAAGGGCGTGTGCGCTAGTTCCAGTGGTGCATCGTCACCACAACCCCCATTCTTTACGATTGGTAACTGGAAAGAACCAAATGACCTAAAGCAAAAATGCAACGGTCCGGTGTCGTGCTTCGTGCCGACGCCGCCCTGTACATTATACCTAATAACA                                          MW447712                         Pseudo-nitzschia americana                  4                                       QIIME2 naiveBayes    YES               nd                                                                            
ASV_seq32      AAGGATCATTACCACACCGATCCAAGATCTGTCTTCATTGTGAATCTGATCTCAGTAGCTAGCTTCACGGCTAGCATACTGTCGTCAAACTTCATCGCGGTGCAGCCAGTAACATGGCTGTCTCGTTAGTCCAAAAACACTCCCATTCTATATGGAAACCGGCTTAACCAAATGACCTAAAGCTTAAAGTGCAGCTGGTCTGGTGCTTAGCACCGTGTGCCCTGTACAAAAACCTAATGAC                                                                                              MW447689                         Pseudo-nitzschia galaxiae                   5                                       QIIME2 naiveBayes    YES               nd                                                                            
ASV_seq35      AAGGATCATTACCACACCGATCCAAGATCTGTCTTCATTGTGAATTCGGATGGCATGGGCAGCAGCTTGACTGCTGTACTATGTCGTCCACTGTGTTTGGCTCGTGACTTTTGTTGCGAGCCATCCATATTTCTTCTATATGGTAAAACAATTTATATGTAATTTGCTGATTTTACTAACTAGTTTTACTACTACTAGTACTAATCTGCAAGATCCAAATGACCTAAAGCTAAAGTGCAGCTGGTCCGGTGTTGTGCCTCGTGCCAACACTACCCTGTACACAAAACCTAATGAC                                        MW447692                         Pseudo-nitzschia calliantha                 5                                       QIIME2 naiveBayes    YES               nd                                                                            
ASV_seq48      AAGGATCATTACCACACCGATCCAAGATCTGTCTTCATTGTGAATCTGATTTCAGTAGCTACTTTAGCATACTGTCGTCAAACTTAATCGCGGTGCAGTCTTTTGACTGTCTCGTTAGTCCAAAAACACTCCCATTCTATATGGAAACCGGCTTAACCAAATGACCTAAAGCTAAAAGTGCAGCTGGTCTGGTGCTTAGCACCGTGTGCCCTGTACAAAAACCTAATGACTT                                                                                                       MW447705                         Pseudo-nitzschia galaxiae                   6                                       QIIME2 naiveBayes    YES               nd                                                                            
ASV_seq51      AAGGATCATTACCACACCGATCCAAGATCTGTCTTCATTGTGAATTCGGATGGAATGGGCAGCAGCTTGACTGCTGTACTATGTCGTCCACTGTGTTTGGCTCGTGACTTTTGTTGCGAGCCATCCATATTTCTTCTATATGGTAAAACAATTTATATGTAATTTGCTGATTTTACTAACTAGTTTTACTACTACTAGTACTAATCTGCAAGATCCAAATGACCTAAAGCTTAAAGTGCAGCTGGTCCGGTGTTGTGCCTCGTGCCAACACTACCCTGTACACAAAACCTAATGAC                                       MW447708                         Pseudo-nitzschia calliantha                 6                                       QIIME2 naiveBayes    YES               nd                                                                            
ASV_seq54      AAGGATCATTACCACACCGATACAAGATCTGTCTTCATTGTGAATTCGGATGGCATGGGCAGCAGCTTGACTGCTGTACTATGTCGTCCACTGTGTTTGGCTCGTGACTTTTGTTGCGAGCCATCCATATTTCTTCTATATGGTAAAACAATTTATATGTAATTTGCTGATTTTACTAACTAGTTTTACTACTACTAGTACTAATCTGCAAGATCCAAATGACCTAAAGCTTAAAGTGCAGCTGGTCCGGTGTTGTGCCTCGTGCCAACACTACCCTGTACACAAAACCTAATGAC                                       MW447711                         Pseudo-nitzschia calliantha                 7                                       QIIME2 naiveBayes    YES               nd                                                                            
ASV_seq100     AAGGATCATTACCACACCGATCCAAGATCAGTCTTCATTGTGAATCTGATTTCAGAGGCAGCAGCTAGCTGTCGTTCTCTGTCGTCAACTTTAACCCTGGTAACTAGCAAGTCCACTTTTTTGGAAGTGGACCGGTTGGCTATCAACTTTACCCATAGCGACACGAGCGTCGGCATCGTTTCACTCGCCCCCCCCATATATTCTTATATATGTGAACTAGCAAGAACCAAATGACCTAAAGCCAAAGTGCAGTGATCTGGTGCTGAGCCTCGTGCCAGCGCCGCCCTGTACACAAACCTAATGAC                              MW447757                         Pseudo-nitzschia sp.                        nd                                      megablast            NO                Closest similarity to P. delicatissima                                        
ASV_seq101     AAGGATCATTACCACACCGATCCAAGATCAGTCTTCATTGTGAATCTGATTTCAGAGGCAGCAGCTAGTTGTCGTTCTCTGTTGTCAACTTTAACCCTGGTAACTAGCAAGTCCACGTTTTTGGAAGTGGACCGGTTGGCTATCAACTTTACCCATAGCGACCTGAGCGTCGGCATCGTTTCACGCACCCCCCATATATTCTTATATATGTGAACTAGAAAGAACCAAATGACCTAAAGCCAAAGTGCAGTGATCTGGTGCTGAGCCTGGTGCCAGCGCCGCCCTGTACACAAACCTAGTCAC                                MW447758                         Pseudo-nitzschia sp.                        nd                                      megablast            NO                Closest similarity to P. delicatissima                                        
ASV_seq102     AAGGATCATTACCACACCGATCCAAGATCTGTCTTCATTGTGAATCTGATTGCGCTAGTAACATTAATTTGGAGCTAGAGCCGTCAAACTTATATATTTCCTTGTGGTCCCGCCCGAGCTGGTTTTACCAGCAGAGGCCGCACTGCCTGGATCTTACTTTTAGGAGCGAGCACTGCTTAGCAACTTACACGCCCACCCCCCATGTATATTTCTATATGGTAACTGGACCGAACCAAATGACCTAAAGCTTAAAGTGCAGTAGGAAGCATCGTGCTACTTGTAGCCGGTGCAGCCCTGTACAAAAACCTAATGAC                     MW447759                         Pseudo-nitzschia cuspidata                  nd                                      QIIME2 naiveBayes    NO                nd                                                                            
ASV_seq103     AAGGATCATTACCACACCGATCCAAGATCTGTCTTCATTGTGAATCTGATTGCGCTAGTAACATTAATTTGCTGCTAGAGCCGTCAAACTTATATATTTCCTTGTGGTCCCGCCCGAGCTGGTTTTACTACTAGCAGAGGCCGCACTGCCTGGATCTTACTTTTTAGGAGCGAGCACTGCTTAGCAACTTACACGCCCACCCCCCATGTATATTTCTATATGGTAACTGGACCGAACCAAATGACCTAAAGCTTAAAGTGCAGTAGGAAGCATCGCGCTACTTGTAGCCGGTGCAGCCCTGTACAAAAACCTAATGAC                 MW447760                         Pseudo-nitzschia pseudodelicatissima        nd                                      megablast            NO                nd                                                                            
ASV_seq104     AAGGATCATTACCACACCGATCCAAGATCAGTCTTCATTGTGAATCTGATTGCAGTGGCTTAGGTTTTTAATCTAGACTACTGTAGCCAAACTTAACCGGCAACCCTCGAGAGTAATCTCGGGTTGCCCGCCACTCTTTACGATTGGTAACTGGAAAGAACCAAATGACCTAAAGCTAAAGTGCAGTTGGTCTGGTGTTGCGCCTTGTGCCAACACCGCCCTGTACACAAACCTAATGAC                                                                                               MW447761                         Pseudo-nitzschia multiseries                nd                                      QIIME2 naiveBayes    NO                nd                                                                            
ASV_seq105     AAGGATCATTACCACACCGATCCAAGATCTGTCTTCATTGTGAATCTGATTGCGCGAGTACCATTAGCATTAGCTTTTGCTGCTAGCGCCGTCAAACTTATATATTTCCTTGTGGTCCCGCCCGAGCTGGTTTTACTAGCGAAGGCCGCACTGCCTGGATCTTACTTTCAGGAGCGAGCACTGCTTAGCAACTTACACGCCCACCCCCCATGTATATTATTTTATATGGTAACTGGACCGAACCAAATGACCTAAAGCTTAAAGTGCAGTAGGAAGTATCGTGCTACTTGTAGCCGGTGCGGCCCTGTACAAAAACCTAATGAC           MW447762                         Pseudo-nitzschia plurisecta                 nd                                      QIIME2 naiveBayes    NO                nd                                                                            
ASV_seq108     AAGGATCATTACCACACCGATCCAAGATCAGTCTTCATTGTGAATTTGATCTCAGTGACAGCTTTGTCTGTTGCTGTGGTCCACTTACCGGTAGCTTTCTGTCCCCTCCTTAACTGTGACTGGGACGATCGTACCAACCCCAATTTCTATATTGGTAACCTTGCCAGAACCAAATGACCTAAAGCTATAAAGTGCAGTGGTCCGGCGACTGAGCCTAGTGCCAGGCGCCGCCCTGTACGTCAAACCTAATGAC                                                                                  MW447765                         Pseudo-nitzschia sp.                        nd                                      megablast            NO                nd                                                                            
ASV_seq109     AAGGATCATTACCACACCGATCCAAGATCGGTCTTCATTGTGAATCTGATTGCAGTGGCTTAGGTTTTTAATCTAGACTACTGTAGTCAAACTTAACCGGCAACCCTCGAGAGTAATCTCGGGTTGCCCGCCACTCTTTACGATTGGTAACTGGAAAGAACCAAATGACCTAAAGTAGAAATGATGCAGTGTTTCGGAGCGCTGAGCGGGCGTCTTAAGTATTAGATGCATACCAAACCGACTCTATTGCTGGCACTGCACATTACACCCTAATACA                                                          MW447766                         Pseudo-nitzschia pungens var. pungens       nd                                      QIIME2 naiveBayes    NO                nd                                                                            
ASV_seq110     AAGGATCATTACCACACCGATCCAAGATCTGTCTTCATTGTGAATTTGACTCTGGCTTGCTGCTTAGCCTCTTAGCTCTGTGGCAGCCACATAGTCAGTCTTAGTAACACGCGGTCCATGTAAATTTTGCCCGAGCCTTGAGTTGATGGAAACATCGTAAATAACCCTCTTGGTGGTGAGAACAGCTTTACTTGTCCCGTTAGCTCTAAAAACCCCCCCATTCTATATGGTAACTGTATTGACCCAAATGACCTAAAGTATAAAGTATATTCGGACTTGGTTGCCTAGCGGCTTCCGGTGCCCTGTACGTAAAACCTAATTGAC           MW447767                         Pseudo-nitzschia dolorosa                   nd                                      megablast            NO                nd                                                                            
ASV_seq111     AAGGATCATTACCACACCGATCCAAGATCTGTCTTCATTGTGAATTCGGATGGCATGGGCAGCAGCTTGACTGCTGTACTATGTCGTCCTTTTGTTGCGAGCCATCCATATTTCTTCTATATGGTAAAACAATTTATATGTAATTTGCTGATTTTACTAACTAGTTTTACTACTACTAGTACTAATCTGCAAGATCCAAATGACCTAAAGCTTAAAGTGCAGCTGGTCCGGTGTTGTGCCTCGTGCCAACACTACCCTGTACACAAAACCTAATGAC                                                          MW447768                         Pseudo-nitzschia calliantha                 nd                                      QIIME2 naiveBayes    NO                nd                                                                            
ASV_seq112     AAGGATCATTACCACACCGATCCAAGATCTGTCTTCATTGTGAATTCGATTGTGGAGCCAGCTTCTGTTCTGCAGAGCTGTACTTCATCGTCGGCCTTTATTTCTTCCCTTCTGTTGCCACTCTGTGGTGATGGATTGGATCCCCCCCATTTCATATGGTAACTAGAACAACACATGACCTAAAGCAAAAGTGCAGCTGGTTTGGTGCCTGGCCTCGGTCGGCACCCCCTGTACATAAAACCTAATGAC                                                                                      MW447769                         Pseudo-nitzschia sp.                        nd                                      megablast            NO                Closest similarity to Pseudo-nitzschia clone M_cln33 (GenBank: EU068675.1)    
ASV_seq113     AAGGATCATTACCACACCGATCCAAGATCAGTGTTCATTGTGAATCTGATTTCAGAGGCAGCAGCTAGCTGTCGTTCTCTGTCGTCAACTTTAACCCTGGTAACTAGCAAGTCCACTTTTTTGGAAGTGGACCGGTTGGCTATCAACTTTACCCATAGCGACCTGAGCGTCGGCATCGTTTCACTCGCCCCCCCCATATATTCTTATATATGTGAACTAGCAAGAACCAAATGACCTAAAGCCAAAGTGCAGTGATCTGGTGCTGAGCCTCGTGCCAGCGCCGCCCTGTACACAAACCTAATGAC                              MW447770                         Pseudo-nitzschia sp.                        nd                                      megablast            NO                Closest similarity to P. delicatissima                                        
ASV_seq28      AAGGATCATTACCACACCGATCCAAGATCAGTCTTCATTGTGAATCTGATTGCACCGGTCTAGTATTTTTACTAAACTGCTGCCGTCAAACTTAAACTTGCAACGCGATGATTAATTCCGCGTTGCTGCCATTCTTTACGATTGGTAACTGGAAAGAACCAAATGACCTAAAGTAGAAATGATGCAGTGTTTCGGAGCGCTGAGCGGGCATCTTAAGTATTAGATGTATACCAAACCGACTCTATTGCTGGCACTGCACATTACACCCTAATACA                                                            MW447685                         Pseudo-nitzschia pungens var. cingulata     nd                                      QIIME2 naiveBayes    NO                nd                                                                            
ASV_seq31      AAGGATCATTACCACACCGATCCAAGATCAGTCTTCATTGTGAATCTGATTTCAGAGGCGGCTTGCTTTTAAAGCTCTCCGTCTCTGTCATCAAACTTTTTTAGTGATGTGCTAGCTACTAGCGTATTACAACCCCCCATTCTTAACGATTGGTAACTGGAAAGAACCAAATGACCTAAAGCTAAAATGCAGTGGTCTGGTGTTGCGCCTCGTGCCAACACCGCCCTGTACATTATACCAATTCA                                                                                          MW447688                         Pseudo-nitzschia australis                  nd                                      QIIME2 naiveBayes    NO                nd                                                                            
ASV_seq37      AAGGATCATTACCACACCGATCCAAGATCAGTCTTCATTGTGGATCTGATTTCAGAGGCAGCCTCGCTGTTCTCTGTCGTCAACTTTAACCCTGGTGCTATCCAGCCCGTGCAATACCTTGTGTTTGTGTGGGTTGGTTGGTGTCCACTTTACCCCCCATATTCTATATGGAAACTGGAAAGAACCAAATGACCTAAAGCTAAAGTGCAGTTGGTCTGGTGTTGCGCCTTGTGCCAACACCGCCCTGTACACAAACCTAATGAC                                                                       MW447694                         Pseudo-nitzschia delicatissima              nd                                      QIIME2 naiveBayes    NO                nd                                                                            
ASV_seq40      AAGGATCATTACCACACCGATCCAAGATCTGTCTTCATTGTGAATTCGGATGGCATTGGCAGCATTAACGTGCTGTACTTTGTCGTCCACTGTGTTTGGCTTGTATTTGCGTGCAGATGCAGGCCATCCATATTTCTTCTATATGGTAAAACTTATATGAAATTTGTTGATTCTAGTCTTTACTAGTAATCTGCAAGACCGAAATGACCTAAAGCTAAAGTGCAGCTGGTTTGGTGCTGAGCTTCGTGCCAGCACCACCCTGTACATAAAACCTAATGAC                                                       MW447697                         Pseudo-nitzschia hasleana                   nd                                      QIIME2 naiveBayes    NO                nd                                                                            
ASV_seq41      AAGGATCATTACCACACCGATCCAAGATCAGTCTTCATTGTGAATCTGATTTCAGAGGCGGCTTGCTTTTAAAGCTCTCCGTCGCTGTCGTCAAACTATTTTCAGTGATATGCTATTTACTAGTGTATCACAACCCCCCATTCTTAACGATTGGTAACTGGAAAGAACCAAATGACCTAAAGCTAAAATGCAGTGGTCTGGTGTTGCGCCTCGTGCCAACACCGCCCTGTACATTATATCAATTCA                                                                                         MW447698                         Pseudo-nitzschia seriata                    nd                                      QIIME2 naiveBayes    NO                nd                                                                            
ASV_seq44      AAGGATCATTACCACACCGATCCAAGATCTGTCTTCATTGTGAATCTGATTTCAGGGGCAACTAGCTTCTAGTTGTTCTCTGTCGTCAAAATTTGTATGATTCTAGGTTACCTGCACTTAGTGTAGATGAGCTTGAATCAGTGACCTCTGCTTCATGTCACAACCCCCATTCTATATGGTAACTGGAAAGAACCAAATGACCTAAAGCTAAAGTGCAGTGGTCTGGTGTTGTACCTTTGGTCAACACCACCCTGTACACAAAACCTAATGAC                                                               MW447701                         Pseudo-nitzschia lineola                    nd                                      QIIME2 naiveBayes    NO                nd                                                                            
ASV_seq46      AAGGATCATTACCACACCGATCCAAGATCAGTCTTCATTGTGGATCTGATTTCAGAGGCAGCCTCGCTGTTCTCTGTCGTCAACTTTAACCCTGGTGCTATCCAGCCCGTGCAATACCTTGTGTTTGTGTGGGTTGGTTGGTGTCCACTTTACCCCCCATATTCTATATGGAAACTGGAAAGAACCAAATGATCTAAAGCTAAAGTGCAGTTGGTCTGGTGTTGCGCCTTGTGCCAACACCGCCCTGTACACAAACCTAATGAC                                                                       MW447703                         Pseudo-nitzschia delicatissima              nd                                      QIIME2 naiveBayes    NO                nd                                                                            
ASV_seq47      AAGGATCATTACCACACCGATCCAAGATCAGTCTTCATTGTGTATCTGATTGCACCGGTCTAGTATTTTTACTAAACTGCTGCCGTCAAACTTAAACTTGCAACGCGTTGATTAATTCCGCGTTGCTGCCATTCTTTACGATTGGTAACTGGAAAGAACCAAATGACCTAAAGTAGAAATGATGCAGTGTTTCGGAGCGCTGAGCGGGCGTCTTAAGTATTAGATGCATACCAAACCGACTCTATTGCTGGCACTGCACATTACACCCTAATACA                                                            MW447704                         Pseudo-nitzschia pungens var. pungens       nd                                      QIIME2 naiveBayes    NO                nd                                                                            
ASV_seq49      AAGGATCATTACCACACCGATCCAAGATCAGTCTTCATTGTGAATCTGATTTCAGAGGCGGCTTGCTTTTAAAGCTCTCCGTCCCTGTCGTCAAACTTTTTTAGTGATGCGCTAGCTACTAGCGTATTACAACCCCCCATTCTTAACGATTGGTAACTGGAAAGAACCAAATGACCTAAAGCTAAAATGCAGTGGTCTGGTGTTGCGCCTCGTGCCAACACCGCCCTGTACATTATACCAATTCA                                                                                          MW447706                         Pseudo-nitzschia australis                  nd                                      QIIME2 naiveBayes    NO                nd                                                                            
ASV_seq50      AAGGATCATTACCACACCGATCCAAGATCTGTCTTCATTGTGAATCTGATTTCAGTAGCTACTTTAGCATACTGTCGTCAAACTTCATCGCGGTGCAGTCTTTTGACTGTCTCGTTAGTCCAAAAACACTCCCATTCTATATGGAAACCGGCTTAACCAAATTACCTAAAGCTAAAAGTGCAGCTGGTCTGGTGCTTAGCACCGTGTGCCCTGTACAAAAACCTAATGACTT                                                                                                       MW447707                         Pseudo-nitzschia galaxiae                   nd                                      QIIME2 naiveBayes    NO                nd                                                                            
ASV_seq52      AAGGATCATTACCACACCGATCCAAGATCAGTCTTCATTGTGAATTTGATTTGCGTGGCACTCTGGCTTCGGCCTGTTTGCCTCAAAAGTCAACTTGTATACAGGTGGCCTTGTCCCCCCCTGCGCACAGTACACCTGTGTTCGGCGCGCGACATCGCACCAGTGGCATTAAGTGAAATGTCCACACCCCATCTTTTACGATCGGTAACTTGATAGAACCAAATGACCTAAAGCTTAAAGTGCAGTGGTCCGGCAACTGAGCCTTGTGCCAGGAGCCGCCCTGTACATAAAACCTAATGAC                                  MW447709                         Pseudo-nitzschia fraudulenta                nd                                      QIIME2 naiveBayes    NO                nd                                                                            
ASV_seq53      AAGGATCATTACCACACCGATCCAAGATCTGTCTTCATTGTGAATCTGATCTCAGTAGCTAGCTTCACCGCTAGCATACTGTCGTCAAACTTCATCGCGGTGCAGCCAGTAACATGGCTGTCTCGTTAGTCCAAAAACACTCCCATTCTATATGGAAACCGGCTTAACCAAATGACCTAAAGCTTAAAGTGCAGCTGGTCTGGTGCTTAGCACCGTGTGCCCTGTACAAAAACCTAATGAC                                                                                              MW447710                         Pseudo-nitzschia galaxiae                   nd                                      QIIME2 naiveBayes    NO                nd                                                                            
ASV_seq56      AAGGATCATTACCACACCGATCCAAGATCTGTCTTCATTGTGAATCTGATCTCAGTAGCTAGCTTCACCGCTAGCATACTGTCGTCAAACTTCATCGCGGTGCAGCCAGTAACATGGCTGTCTCGTTAGTTCAAAAACACTCCCATTCTATATGGAAACCGGCTTAACCAAATGACCTAAAGCTTAAAGTGCAGCTGGTCTGGTGCTTAGCACCGTGTGCCCTGTACAAAAACCTAATGAC                                                                                              MW447713                         Pseudo-nitzschia galaxiae                   nd                                      QIIME2 naiveBayes    NO                nd                                                                            
ASV_seq57      AAGGATCATTACCACACCGATCCAAGATCTGTCTTCACTGTGAATTCGGATGGCATGGGCAGCAGCTTGACTGCTGTACTATGTCGTCCACTGTGTTTGGCTCGTGACTTTTGTTGCGAGCCATCCATATTTCTTCTATATGGTAAAACAATTTATATGTAATTTGCTGATTTTACTAACTAGTTTTACTACTACTAGTACTAATCTGCAAGATCCAAATGACCTAAAGCTTAAAGTGCAGCTGGTCCGGTGTTGTGCCTCGTGCCAACACTACCCTGTACACAAAACCTAATGAC                                       MW447714                         Pseudo-nitzschia calliantha                 nd                                      QIIME2 naiveBayes    NO                nd                                                                            
ASV_seq58      AAGGATCATTACCACACCGATCCAAGATCTGTCTTCATTGTGAATCTGATCTCAGTAGCTAGCTTCACCGCTAGCATACTGTCGTCAAACTTCATCGCGGTGCAGCCAATAACATGGCTGTCTCGTTAGTCCAAAAACACTCCCATTCTATATGGAAACCGGCTTAACCAAATGACCTAAAGCTTAAAGTGCAGCTGGTCTGGTGCTTAGCACCGTGTGCCCTGTACAAAAACCTAATGAC                                                                                              MW447715                         Pseudo-nitzschia galaxiae                   nd                                      QIIME2 naiveBayes    NO                nd                                                                            
ASV_seq59      AAGGATCATTACCACACCGATCCAAGATCAGTCTTCATTGTGAATTCGATTGCAGTGGCAACTGGCTCATCTAGAGTCTTTTGTCAGTGTCGTCAACTTTCTGCTAGGTGACGAGCTTGCATAGTAATAGCCTGCCAGTATTGTATTGTATATATATCACTGGCAGAGCTAATGCATTCTTCCACTGGCCCCCCCAATTCTTATTCTTAACGATTGGTAACTGGAAAGAACCAACTGACCTGAAGCAAAAATGCAGAGGTTAGGCGCTGCGCCTTGTTGCCAGTGCCACCCTGTACATTATACCTAATACA                        MW447716                         Pseudo-nitzschia multistriata               nd                                      QIIME2 naiveBayes    NO                nd                                                                            
ASV_seq60      AAGGATCATTACCACACTGATCCAAGATCTGTCTTCATTGTGAATCTGATTTCGTTGACAGTCCTTCAGTGGGCTGTACTTCGTCGTCAACATTATTGGGATATGCTGTCATTGCCCACTGTGGTGATGGTAGTTGTCCCGCGATCTGCCATATCAGCCTTGTGCTGTAGCGGGTCGCAAACCCCCCATTCTATATGGTAACCCGAAAGAACCAAATGACCTAAAGTAAAATGTGCAGATGGTCTGGTGTTGTGCTTAGTGCCAACACCGATCCTGTACACAAAACCTAATGAC                                         MW447717                         Pseudo-nitzschia heimii                     nd                                      QIIME2 naiveBayes    NO                nd                                                                            
ASV_seq61      AAGGATCATTACCACACCGATCCAAGATCAGTCTTCATTGTGAATCTGATTTCAGAGGCAGCCTCGCTGTTCTCTGTCGTCAATTTTAACCCTGGTGCTATCCAGCCCGTGCAATACCTTGTGTTTGTGTGGGTTGGTTGGTGTCCACTTTACCCCCCATATTCTATATGGAAACTGGAAAGAACCAAATGACCTAAAGCTAAAGTGCAGTTGGTCTGGTGTTGCGCCTTGTGCCAACACCGCCCTGTACACAAACCTAATGAC                                                                       MW447718                         Pseudo-nitzschia delicatissima              nd                                      QIIME2 naiveBayes    NO                nd                                                                            
ASV_seq63      AAGGATCATTACCACACCGATCCAAGATCAGTCTTCATTGTGAATTTGATTTGCGTGGCACTCTGGCTTCGGCCCGTTTGCCTCAAAAGTCAACTTGTATACAGGTGGCCTTGTCCCCCCCTGCGCACAGTATACCTGTGTTCGGCGCGCGACATCGCACCAGTGGCATTAAGTGAAATGTCCACACCCCATCTTTCACGATCGGTAACTTGATAGAACCAAATGACCTAAAGCTTAAAGTGCAGTGGTCCGGCAACTGAGCCTTGTGCCAGGAGCCGCCCTGTACATAAAACCTAATGAC                                  MW447720                         Pseudo-nitzschia fraudulenta                nd                                      QIIME2 naiveBayes    NO                nd                                                                            
ASV_seq64      AAGGATCATTATCACACCGATCCAAGATCAGTCTTCATTGTGAATTTGATTTGCGTGGCACTCTGGCTTCGGCCCGTTTGCCTCAAAAGTCAACTTGTATACAGGTGGCCTTGTCCCCCCTGCGCACAGTATACCTGTGTTCGGCGTGCGACATCGCACCAGTGGCATTAAGTGAAATGTCCACATCCCATCTTTTACGATCGGTAACTTGATAGAACCAAATGACCTAAAGCTTAAAGTGCAGTGGTCCGGCAATTGAGCCTTGTGCCAGGAGCCGCCCAGTACATAAAACCTAATGAC                                   MW447721                         Pseudo-nitzschia fraudulenta                nd                                      QIIME2 naiveBayes    NO                nd                                                                            
ASV_seq66      AAGGATCATTACCACACCGATCCAAGATCTGTCTTCATTGCGAATCTGATTTCGTTGACAGTCCTTCAGTGGGCTGTACTTCGTCGTCAACATTATTGGGATATGCTGCCATTACCCACTGTGGTGATGGTAGTTGTCCCGCGATCTGCCATATCAGCCTTGTGCTGTAGCGGGTCGCAAACCCCCCATTCTATATGGTAACCGGAAAGAACCAAATGACCTAAAGTAAAATGTGCAGATGGTCTGGTGTTGTGCTTAGTGCCAACACTGATCCTGTACACAAAACCTAATGAC                                         MW447723                         Pseudo-nitzschia subpacifica                nd                                      QIIME2 naiveBayes    NO                nd                                                                            
ASV_seq67      AAGGATCATTACCACACTGATCCAAGATCAGTCTTCATTGTAAATCCGATTTCAGAGGCAGCTTCTGGTTGTTCTCTGTCGTCAACTTTAATATGGTACTAGCTTGCTAGAACCAGTGACCTCTGTTTCACGTCACACCCCCCATTCTATATGGTAACTGGAAAGAACCAAATGACCTAAAGCTTAAAGTGCAGCTGGTCTGGTATCGTGCCTTGTGCCGATGCCACCCTGTACAAAAAACCTAATGAC                                                                                      MW447724                         Pseudo-nitzschia turgidula                  nd                                      QIIME2 naiveBayes    NO                nd                                                                            
ASV_seq68      AAGGATCATTACCACACCGATCCAAGATCAGTCTTCATTGTGAATCTGATTGCACCGGTCTAGTATTTTTACTAAACTGCTGCCGTCAAACTTAAACTTGCAACGCGTTGATTAATTCCGAGTTGCTGCCATTCTTTACGATTGGTAACTGGAAAGAACCAAATGACCTAAAGTAGAAATGATGCAGTGTTTCGGAGCGCTGAGCGGGCGTCTTAAGTATTAGATGCATACCAAACCGACTCTATTGCTGGCACTGCACATTACACCCTAATACA                                                            MW447725                         Pseudo-nitzschia pungens var. pungens       nd                                      QIIME2 naiveBayes    NO                nd                                                                            
ASV_seq69      AAGGATCATTACCACACCGATCCAAGATCTGTCTTCATTGTGAATCTGATTGCGCTAGTAGCATTGATAACTAGCTTACCTTTGCTGCTAGTGCCGTCAAACTTATATATTTCCTTGTGGTCCCGCCCGAGTTGGTTTTATTACTAGCAGAGGCCGCACTGCCTGGATCTTACTTTTTAGGAGCGAGCACTGCTTAGCAACTTACACGCCCACCCCCCATGTATATTTCTATATGGTAACTGGACCGAACCAAATGACCTAAAGCTTAAAGTGCAGTAGGAAGCATCGCGCTACTTGTAGCCGGTGCAGCCCTGTACAAAAACCTAATGAC    MW447726                         Pseudo-nitzschia cuspidata                  nd                                      megablast            NO                nd                                                                            
ASV_seq70      AAGGATCATTACCACACCGATCCAAGATCAGTCTTCATTGTGAATTTGATTTGCGTGGCACTCTGGCTTCGGCCCGTTTGCCTCAAAAGTCAACTTGTATACAGGTGGCCTTGTCCCCCCCTGCGCACAGTATACCTGTGTTCGGCGCGCGACATCGCACCAGTGGCATTAAGTGAAATGTCCACACCCCATCTTTTACGATCGGTAACTTGATAGAACCAAATGACCTAAAGCTTAAAGTACAGTGGTCCGGCAACTGAGCCTTGTGCCAGGAGCCGCCCTGTACATAAAACCTAATGAC                                  MW447727                         Pseudo-nitzschia fraudulenta                nd                                      QIIME2 naiveBayes    NO                nd                                                                            
ASV_seq71      AAGGATCATTACCACACCGATCCAAGATCTGTCTTCATTGTGAATCTGATTTCGTTGACAGTCCTTCAGTGGGCTGTACTTTGTTGTCAACATTATTGGGATATGCTGCCATTGCCCACTGTGATGATGGTAGTTGTCCCGCGATCTGCCATATCAGCCTTGTGCTGTAGCGGGTCGCAAACCCCCCATTCTATATGGTAACCGGAAAGAACCAAATGACCTAAAGTAAAATGTCCAGATGGTCTGGTGTTGTGCTTAGTGCCAACACCGATCCTGTACACAAAACCTAATGAC                                         MW447728                         Pseudo-nitzschia subpacifica                nd                                      QIIME2 naiveBayes    NO                nd                                                                            
ASV_seq72      AAGGATCATTACCACACCGATCCAAGATCAGTCTTCATTGTGAATCTGATTGCAGTGGCTTAGGTTTTTAATCTAGACTACTGTAGTCAAACTTAACCGGCAACACTCGAGAGTAATCTCGGGTTGCCCGCCACTCTTTACGATTGGTAACTGGAAAGAACCAAATGACCTAAAGCTAAAATGCAGAGGCTTGGCACTGATACTTTGCTGTCAGTGTGGCCCTGCAGATTATACCTAATACA                                                                                             MW447729                         Pseudo-nitzschia multiseries                nd                                      QIIME2 naiveBayes    NO                nd                                                                            
ASV_seq73      AAGGATCATTACCACACCGATCCAAGATCTGTCTTCATTGTGAATCTGATTTCGTTGACAGTCCTTCAGTGGCCTGTACTTCGTCGTCAACATTATTGGGATATGCTGCCATTACCCACTGTGGTGATGGTAGTTGTCCCGCGATCTGCCATATCAGCCTTGTGCTGTAGCGGGTCGCAAACCCCCCATTCTATATGGTAACCGGAAAGAACCAAATGACCTAAAGTAAAATGTGCAGATGGTCTGGTGTTGTGCTTAGTGCCAACACTGATCCTGTACACAAAACCTAATGAC                                         MW447730                         Pseudo-nitzschia subpacifica                nd                                      QIIME2 naiveBayes    NO                nd                                                                            
ASV_seq74      AAGGATCATTACCACACCGATCCAAGATCTGTCTTCATTGTGAATCTGATTGCGCGAGTACCATTAGCATTCGCTTTTGCTGCTAGCGCCGTCAAACTTATATATTTCCTTGTGGTCCCGCCCGAGCTGGTTTTACTAGCGAAGGCCGCACTGCCTGGATCTTACTTTCAGGAGCGAGCACTGCTTAGCAACTTACACGCCCACCCCCCATGTATATTATTTTATATGGTAACTGGACCGAACCAAATGACCTAAAGCTTAAAGTGCAGTAGGAAGCATCGTGCTACTTGTAGCCGGTGCGGCCCTGTACAAAAACCTAATGAC           MW447731                         Pseudo-nitzschia plurisecta                 nd                                      QIIME2 naiveBayes    NO                nd                                                                            
ASV_seq76      GAAGGATCATTACCACACCGATCCAAGATCTGTCTTCATTGTGAATCTGATTTCAGTAGCGGCTTCGGCCTGCATACTGTCGTCAAACTTCTTCGCGGTACATTATGTCCCGTTAGTCCAAAAACCTCCCCATTCTATATGGAAACTGGCTATAACCAAATGACCTAAAGCTAAAGTGCAGTTGGTCTGGTGCTTTGCACCGTGTGCCCTGTACAAAAACCTAATGAC                                                                                                           MW447733                         Pseudo-nitzschia sabit                      nd                                      QIIME2 naiveBayes    NO                nd                                                                            
ASV_seq77      AAGGATCATTACCACACCGATCCAAGATCTGTCTTCATTGTGAATCTGATTTCGTTGACAGTCCTTCAGTGGGCTGTACTTCGTCGTCAACATTATTGGGATATGCTGTCATTGCCCACTGTGGTGATGGTGGTTGTCCCGTGATCTGCCATATCAGCCTTGTGCTGTAGCGGATCGCAAACCCCCCATTCTATATGGTAACCGGAAAGAACCAAATGACCTAAAGTAAAATGTGCAGATGGTCTGGTGTTGTGCTTAGTGCCAACACCGATCCTGTACACAAAACCTAATGAC                                         MW447734                         Pseudo-nitzschia heimii                     nd                                      QIIME2 naiveBayes    NO                nd                                                                            
ASV_seq78      AAGGATCATTACCACACCGATCCAATATCTGTCTTCATTGTGAATTCGGATGGCATGGGCAGCAGCTTGACTGCTGTACTATGTCGTCCACTGTGTTTGGCTCGTGACTTTTGTTGCGAGCCATCCATATTTCTTCTATATGGTAAAACAATTTATATGTAATTTGCTGATTTTACTAACTAGTTTTACTACTACTAGTACTAATCTGCAAGATCCAAATGACCTAAAGCTTAAAGTGCAGCTGGTCCGGTGTTGTGCCTCGTGCCAACACTACCCTGTACACAAAACCTAATGAC                                       MW447735                         Pseudo-nitzschia calliantha                 nd                                      QIIME2 naiveBayes    NO                nd                                                                            
ASV_seq80      AAGGATCATTACCACACCGATCCAAGATCTGTCTTCATTGTGAATCTGATTGCGCTAGTAGCATTGATAACTAGCTTACCTTTGCTGCTAGTGCCGTCAAACTTATATATTTCCTTGTGGTCCCGCCCGAGCTGGTTTTACTAGCAGAGGCCGCACTGCCTGGATCTTACTTTTTAGGAGCGAGCACTGCTTAGCAACTTACACGCCCACCCCCCATGTATATTTCTATATGGTAACTGGACCGAACCAGATGACCTAAAGCTTAAAGTGCAGTAGGAAGCATCGCGCTACTTGTAGCCGGTGCAGCCCTGTACAAAAACCTAATGAC       MW447737                         Pseudo-nitzschia cuspidata                  nd                                      megablast            NO                nd                                                                            
ASV_seq82      AAGGATCATTACCACACCGATCCAAGATCAGTCTTCATTGTGAATCTGATTTCAGGGGCAGCCATCTGCTATTTATATAGCTTTGGCTGTTCTCTGTCGTCAAACTTAACTTATATTTTTATGCGCGACCTCTGCTTCGGCATCGTTTCACGCCCACCCCCCATTTCTATATGGTAACCGGAAAGAACCAAATGACCTAAAGCTAAAAGTGCAGCTGGTTTGGTGTTGAGCCTCGTGTTCAACACCACCCTGTACATTAAACCTAATGAC                                                                 MW447739                         Pseudo-nitzschia inflatula                  nd                                      QIIME2 naiveBayes    NO                nd                                                                            
ASV_seq83      AAGGATCATTACCACACCGATCCAAGATCTGTCTTCATTGTGAATCTGATTTCGTTGACAGTCCTTCAGTGGGCTGTACTTTGTTGTCAACATTATTGGGATATGCTGCCATTGCCCACTGTGGTGATGGTAGTTGTCCCGCGATCTGCCATATCAGCCTTGTGCTGTAGCGGGTCGCAAACCCCCCATTCTATATGGTAACCGGAAAGAACCAAATGACCTAAAGTAAAATGTCCAGATGGTCTGGTGTTGTGCTTAGTGCCAACACCGATCCTGTACACAAAACCTAATGAC                                         MW447740                         Pseudo-nitzschia subpacifica                nd                                      QIIME2 naiveBayes    NO                nd                                                                            
ASV_seq85      AAGGATCATTACCACACCGATCCAAGATCTGTCTTCATTGTGAATCTGATTTCGTTGACAGTCCTTCAGTGGGCTGTACTTCGTCGTCAACATTATTGGGATATGCTGCCATTACCCACTGTGGTGATGGTAGTTGTCCTGCGATCTGCCATATCAGCCTTGTGCTGTAGCGGGTCGCAAACCCCCCATTCTATATGGTAACCGGAAAGAACCAAATGACCTAAAGTAAAATGTGCAGATGGTCTGGTGTTGTGCTTAGTGCCAACACCGATCCTGTACACAAAACCTAATGAC                                         MW447742                         Pseudo-nitzschia subpacifica                nd                                      QIIME2 naiveBayes    NO                nd                                                                            
ASV_seq86      AAGGATCATTACCACACCGATCCAAGATCTGTCTTCATTGTGAATCTGATTGCGCTAGTAGTAATTTATTTTATTTTGCTGCTAGCACCGTCAAACTTATATATTTCCTTGTGGTCCCGCCCGAGCTGGTAGTTTTACTGCTAGCGGAGGCCGCACTGCCTGGATCTTACTATTCAGGAGCGAGCACTGCTTAGCAACTTACACGCCCACCCCCCCATGTATATTTTATATGGTAACTGGACCGAACCAAATGACCTAAAGCTTAAAGTGCAGTAGGAAGCATCGTGCTACTTGTAGCCGGTGCGGCCCTGTACAAAAACCTAATGAC       MW447743                         Pseudo-nitzschia cuspidata                  nd                                      QIIME2 naiveBayes    NO                nd                                                                            
ASV_seq87      AAGGATCATTACCACACCGATCCAAGATCTGTCTTCATTGTGAATCTGATTTCGTTGACAGTCCTTCAGTGGGCTGTACTTCGTCGTCAACATTATTGGGATATGCTGTCATTGCCCACTGTGGTGATGGTAGTTGTCCCGCGATCTGCCATATCAGCCTTGTGCTGTAGCGGGTCGCAAACCCCCCATTCTATATGGTAACCGGAAAGAACCAAATGACCTAAAGTAAAATGTGCAGATGGTCTGGTGTTGTGCTTAGTGCCAACACCGATCCTGTACACAAAACCTAATGAC                                         MW447744                         Pseudo-nitzschia heimii                     nd                                      QIIME2 naiveBayes    NO                nd                                                                            
ASV_seq88      AAGGATCATTACCACACCGATCCAAGATCTGTCTTCATTGTGAATCTGATTGCGCGAGTACCGTTAGCATTAGCTTTTGCTGCTAGCGCCGTCAAACTTATATATTTCCTTGTGGTCCCGCCCGAGCTGGTTTTACTAGCGAAGGCCGCACTGCCTGGATCTTACTTTCAGGAGCGAGCACTGCTTAGCAACTTACACGCCCACCCCCCATGTATATTATTTTATATGGTAACTGGACCGAACCAAATGACCTAAAGCTTAAAGTGCAGTAGGAAGCATCGTGCTACTTGTAGCCGGTGCGGCCCTGTACAAAAACCTAATGAC           MW447745                         Pseudo-nitzschia plurisecta                 nd                                      QIIME2 naiveBayes    NO                nd                                                                            
ASV_seq90      AAGGATCATTACCACACCGATCCAAGATCTGTCTTCATTGTGAATCTGATTTTGTTGACAATCCTTCAGTGGGCTGTACTTTGTCATCAACATTATTGGGATATGCTGTCATTGCCCACTGTGGTGATGGTAGTTGTCCCGCGATCTGCCATATCAGCCTTGTGCTGTAGCGGGTTGCAAACCCCCCATTCTATATGGTAACCAGAGGAAAGAACCAAATGACCTAAAGTAAAATGTGCAGATGGTCTGGTGTTGTGCTGAGTGCCAACACCAATCCTGTACACAAAACCTAATGAC                                      MW447747                         Pseudo-nitzschia heimii                     nd                                      QIIME2 naiveBayes    NO                nd                                                                            
ASV_seq91      AAGGATCATTACCACACCGATCCAAGATCTGTCTTCATTGTGAATCTGATTGCGCTAGTAGCAAAGTAATTTATTTTGCTGCTAGCACCGTCAAACTTTTATATTTCCTTGTGGTCCCGCCCGAGCTGGTAGTTTTACTGCTAGCGGAGGCCGCACTGCCTGGATCTTACTATTCAGGAGCGAGCTCTGCTTAGCAACTTACACGCCCACCCCCCATGTATATTTTATATGGTAACTGGACCGAACCAAATGACCTAAAGCTTAAAGTGCAGTAGGAAGCATCGCGCTACTTGTAGCCGGTGCGGCCCTGTACAAAAACCTAATGAC        MW447748                         Pseudo-nitzschia cuspidata                  nd                                      QIIME2 naiveBayes    NO                nd                                                                            
ASV_seq92      AAGGATCATTACCACACCAATCCAAGATCTGTCTTCATTGTGAATCTGATTTTGTTGGCAGTCCTTTGGTGGGCTGTACTTTGTCGTCAACATTATTTGGATATGCTGTCATTGCCCACTGTGGTGATGGTAGTTGTCCTGTGATCTGCTATATCAGCCTTGTGCTGTAACCAAACCCCCATTCTATATGGTAACCGGAAAGAACCAAATGACCTAAAGTAAAATGTGCAGATGGTCTGGTGTTGTGCTTAGTGCCAACACCAATCCTGTACACAAAATCTAATGAC                                                MW447749                         Pseudo-nitzschia heimii                     nd                                      QIIME2 naiveBayes    NO                nd                                                                            
ASV_seq93      AAGGATCATTACCACACCGATCCAAGATCAGTCTTCATTGTGGATCTGATTTCAGAGGCAGCCTCACTGTTCTCTGTCGTCAACTTTAACCCTGGTGCTATCCAGCCCGTGCAATACCTTGTGTTTGTGTGGGTTGGTTGGTGTCCACTTTACCCCCCATATTCTATATGGAAACTGGAAAGAACCAAATGACCTAAAGCTAAAGTGCAGTTGGTCTGGTGTTGCGCCTTGTGCCGACACCGCCCTGTACACAAACCTAATGAC                                                                       MW447750                         Pseudo-nitzschia delicatissima              nd                                      QIIME2 naiveBayes    NO                nd                                                                            
ASV_seq94      AAGGATCATTACCACACCGATCCAAGATCTGTCTTCATTGTGAATCTGATTGCGCGAGTACCATTAGCATTAGCTTTTGCTGCTAGCGCCGTCAAACTTATATATTTCCTTGTGGTCCCGCCCGAGCTGGTTTTACTAGCGAAGGCCGCACTGCCTGGATCTTACTTTCAGGAGCGAGCACTGCTTAGCAACTTACACGCCCACTCTCATGTATATTATTTTATATGGTAACTGGACCGAACCAAATGACCTAAAGCTTAAAGTGCAGTAGGAAGCATCGTGCTACTTGTAGCCGGTGCGGCCCTGTACAAAAACCTAATGAC            MW447751                         Pseudo-nitzschia plurisecta                 nd                                      QIIME2 naiveBayes    NO                nd                                                                            
ASV_seq95      AAGGATCATTACCACACCGATCCAAGATCTGTCTTCATTGTGAATCTGATTTCAGTAGCAGCTCCGGCTTGCATACTGTCGTCAAACTTCTTCGCGGTACAAATTACTTTGTCCCGTTTGTCAAAAAACACCCCATTCTATATGGAAACTGGCTATAACCAAATGACCTAAAGCTTAAAGTGCAGCTGGTCTGGTGCTTTGCACCGTGTGCCCTGTACAAAAACCTAATGAC                                                                                                       MW447752                         Pseudo-nitzschia sp.                        nd                                      megablast            NO                Closest similarity to P. sabit                                                
ASV_seq97      AAGGATCATTACCACACCGATCCAAGATCTGTCTTCATTGTGAATTCGATTGTGGAGCCAGCTTCTGTTCTGCAGAGCTGTACTTCATCGTCGGCCTTTATTTCTTCCCTTCTGTTGCCACTCTGTGGTGATGGATTGGATACCCCCCATTTCATATGGTAACTAGAACAACACATGACCTAAAGCAAAAGTGCAGCTGGTTTGGTGCCTGGCCTCGGTCGGCACCCCCTGTACATAAAACCTAATGAC                                                                                      MW447754                         Pseudo-nitzschia sp.                        nd                                      megablast            NO                Closest similarity to Pseudo-nitzschia clone M_cln33 (GenBank: EU068675.1)    
ASV_seq98      AAGGATCATTACCACACCGATCCAAGATCTGTCTTCATTGTGAATCTGATTGCGCTAGTAGCATTGATAACTAGCTTACCTTTGCTGCTAGTGCCGTCAAACTTATATATTTCCTTGTGGTCCCGCCCGAGCTGGTTTTATTACTAGCAGAGGCCGCACTGCCTGGATCTTACTTTTTAGGAGCGAGCACTGCTTAGCAACTTACACGCCCACCCCCCATGTATATTTCTATATGGTAACTGGACCGAACCAAATGACCTAAAGCTTAAAGTGCAGTAGGAAGCATCGCGCTACTTGTAGCCGGTGCAGCCCTGTACAAAAACCTAATGAC    MW447755                         Pseudo-nitzschia cuspidata                  nd                                      megablast            NO                nd                                                                            
ASV_seq99      AAGGATCATTACCACACCGATCCAAGATCTGTCTTCATTGTGAATCTGATTTCAGGGGCAACTAGCTTCTAGTTGTTCTCTGTCGTCAAAATTTGTATGATTCTAGGTTATCTGCACTTAGTGTAGATGAGCTTGAATCAGTGACCTCTGCTTCATGTCACAACCCCCATTCTATATGGTAACTGGAAAGAACCAAATGACCTAAAGCTAAAGTGCAGTGGTCTGGTGTTGTACCTTTGGTCAACACCACCCTGTACACAAAACCTAATGAC                                                               MW447756                         Pseudo-nitzschia lineola                    nd                                      QIIME2 naiveBayes    NO                nd